Tag Archives: cross-cultural communication

Maternal Lineage (activity)

The PCR amplification of the mitochondrial control region

There are 2 hypervariable regions within the control region of the mitochondria. This exercise amplifies just one of these. For more definitive results, both should be amplified and sequenced. This exercise will permit us to have a rough idea of the origins of our maternal line and we will be able to attribute ourselves to various tribes throughout the world. The human mitochondrial genome (genbank file).

Forward Primer 5’-TTAACTCCACCATTAGCACC-3’

Reverse Primer 5’-GAGGATGGTGGTCAAGGGAC-3’

  1. PCR the previously extract DNA  samples
    • Pour 2% agarose into casting apparatus in refrigerator
    • 2 gels per class need to be made → 100ml of TBE with 2g agarose
    • add 5μl SYBR safe solution into the molten agarose before casting
    • place 2 sets of combs into the gel → at one end and in the middle
  1. load gel with DNA ladder and PCR
  2. Run gel at 120V for 20 minutes
  3. Visualize on UV transilluminator
  4. Document with camera to verify amplification
  5. The instructor will submit the viable reactions for sequencing
  6. Analyze data during Bioinformatics Lab session
    1. Using NYCCT email address, register for account at https://dnasubway.cyverse.org/
    2. retrieve reference mitochondrial sequences
    3. perform multiple sequence alignment using MUSCLE
    4. draw phylogenetic trees using PHYLIP and visualize using FigTree

Tags: , , ,

Maternal Lineage

Mitochondrial and Maternal Inheritance

In addition to the 23 chromosomes inherited from mother and 23 chromosomes inherited from father, humans have an additional genome that is only inherited from the mother. This genome comes from the endosymbiotic organelle, the mitochondrion.

Mitochondrial dna lg

Mitochondria are thought to have arisen in the eukaryotic line when bacteria capable of detoxifying the deadly effects of atmospheric oxygen were engulfed by a eukaryote that did not proceed to consume it. Over the course of time, these formerly free-living bacteria became dependent on the eukaryotic cell environment while providing the benefit to the host cell of aerobic respiration. Hallmarks of this endosymbiotic event include: the inner prokaryotic membrane surrounded by the outer eukaryotic membrane, the presence of prokaryotic ribosomes and most significantly, the circular prokaryotic chromosome. Mitochondria still replicate independently of the host cell but can not survive outside of this cellular environment. Animal mitochondria have the simplest genomes of all mitochondrial genomes, ranging from 11-28kb. The human mitochondrial genome consists of 37 genes which are almost all devoted to processing ATP through oxidative phosphorylation.

Human mitochondrial genome

The human mitochondrial genome (genbank file) consists of 16,569 nucleotides (16.6kb). While most of this 16.6kb genome consists of protein encoding genes, approximately 1.2kb non-coding DNA takes part in signals that control the expression of these genes and replication processes. It is the area of DNA where the double-strandedness is displaced and having the name D-loop (displacement loop). Mutations in this area generally have very little effect on the functioning of the mitochondria. Because of this reduced selection pressure on this area, this control region is also referred to as the hypervariable region. This hypervariable region actually has 10 times more SNPs than the nuclear genome. Due to this abundance of mutations, it is possible to track down the maternal line of an individual. Why just maternal? The human oocyte contains many mitochondria while sperm cells only contain mitochondria that power the flagellar motion. Upon fertilization, the flagellum and the associated mitochondria are lost, leaving the zygote with only maternal mitochondria.

The cluster of SNPs found in the mitochondrial control region are linked and are always inherited together. Because of the lack of paternal contribution, this linkage is referred to as a haplotype, or “half-type”. Tracking these polymorphic haplotypes, a family tree of humans was developed in the 1980s which concluded that humans arose from a metaphorical “Mitochondrial Eve” 200,000 years ago. As a metaphor to the Biblical Eve, this alludes to an origin but unlike the Biblical event, this does not mean that it was a single woman that gave rise to all of modern humanity. On the contrary, the metaphor merely indicates that a series of females; sisters and cousins, of this line gave rise to modern humans.

 Mitochondrial Migration Map
Migration map of mitochondrial haplogroups. Numbers represent 1000 years ago. https://commons.wikimedia.org/wiki/File:Map-of-human-migrations.jpg (CC-BY-SA 3.0)

The use of mitochondria for this analysis provides great flexibility, especially from ancient sources. Unlike the nuclear genome which only has 2 copies of DNA per cell, the mitochondria are abundant in number and provide many copies of genome per cell. Ancient sources of DNA in fossils will most often have degradation of the DNA. The mitochondrial genome is just as likely to undergo degradation over time, however the high copy number allows for gaps to be filled in easily. SNPs do not alter the overall size of the hypervariable region, therefore amplification by PCR can not resolve these differences based on agarose gel migration. However, amplicons (amplified copies) can be sent for sequencing whereby each nucleotide can be called out in succession and reveal the specific SNPs.


Tags: , , ,

Alu Insertion (activity)

Alu’s are unique SINEs that appear in the primate lineage and reveal the lineage and diversification of primates. While retrotransposons can disrupt gene (as in some cases of hemophilia), they often land outside of genes or within introns without effect. One example of a non-disruptive Alu element in humans is found in the location called PV92 on chromosome 16. This element is of the youngest subfamily of Alu, called Ya5.

Since PV92 does not cause any deleterious effects, it can be used as a non-selected marker to illustrate lineage. Some people have an Alu element int his location while others do not. The presence or absence of this marker is viewed as an allele. This lab uses primer that flank the location of the Alu insertion that span 416 bp. If an Alu is present, the amplified DNA will be 300bp larger (the size of an Alu) at 731bp.

Exercise: In silico PCR of PV92

Forward primer: 5′ GGATCTCAGGGTGGGTGGCAATGCT 3′
Reverse primer: 5′ GAAAGGCAAGCTACCAGAAGCCCCAA 3′

    1. Perform Virtual PCR Informatics Exercise/Discussion
    2. Find the PCR fragments in Ugene
      1. Download the sample FASTA file: PV92 sample
      2. Open the file in Ugene and select option “As Separate Sequences in Viewer”
      3. Select the “In Silico PCR” button on the far right (double helix button) and insert the primers
        • primerbutton
      4. A PCR product should be noted for one of the sequences after pressing “Find Products anyway”
      5. Click on the second sequence in the viewer and Press “Find Products anyway”
      6. What are the sizes of each product, if any?
      7. What does this inform us?

Exercise: PCR genotype PV92 locus

    1. PCR the individual samples
    2. Pour 2% agarose into casting apparatus in refrigerator
      • 2 gels per class need to be made → 100ml of TBE with 2g agarose
      • add 5μl SYBR safe solution into the molten agarose before casting
      • place 2 sets of combs into the gel → at one end and in the middle
    1. Load DNA ladder and PCR samples
    2. Run gel at 120V for 30 minutes
    3. Visualize on UV transilluminator
    4. Score gels for the presence/absence of the alleles to determine genotype frequency in the class

Tags: , , ,

Tracing Origins

Being Human

Lions painting, Chauvet Cave (museum replica)
Drawings dating to approximately 30,000 years ago in the Chauvet Cave

What constitutes being human? Many will point at a cultural identity and leaving long-standing remnants of that culture. Such prehistorical artifacts like cave drawings and tools provide an anthropological framework for identifying what it is to be human, but the biological identity remains locked in the history of our DNA.

Clovis Rummells Maske
Spear points of the Clovis Culture in the Americas dating to approximately 13,000 years ago. Credit:Bill Whittaker [CC-BY-SA 3.0]

The Great Apes

ape_tree
Phylogenetic tree generated with Cytochrome Oxidase I (COI) genes.

Homo sapiens represent a branch of primates in the line of Great Apes. The family of Great Apes consists of four extant genera: Homo, Pan, Gorilla, Pongo. Karyotype analysis (Yunis et al., 1982) reveals a shared genomic structure between the Great Apes. While humans have 46 chromosomes, the other Great Apes have 48. Molecular evidence at the DNA level indicates that Human Chromosome 2 is a fusion of 2 individual chromosomes. In the other Great Apes, these 2 Chromosomes are referred to as 2p and 2q to illustrate their synteny to the human counterpart.

Synteny map of Human, Chimpanzee, Gorilla, Orangutan and Marmoset (non-ape primate). Mapping of chromosome 2a and 2b in the apes compared to 6 and 14 in the marmoset illustrates the relatedness of the chromosomal structure of the apes. Minor inversions are apparent in the orangutan chromosome. Credit: Jeremy Seto [CC-BY-NC-SA]
Chimpanzees (Pan) are the closest living relatives to modern humans. It is commonly cited that less than 2% differences in their nucleotide sequences exist with humans (Chimpanzee Sequencing and Analysis Consortium, 2005). More recent findings in comparing the complement of genes (including duplication and gene loss events) now describes the difference in genomes at about 6% (Demuth JP, et al., 2006).

Lines
The Pan-Homo divergence. A display at the Cradle of Humankind illuminates the skulls of two extant Hominini with a series of model fossils from the Hominina subtribe of Austrolopithecina and Homo. Credit: Jeremy Seto [CC-BY-NC-SA] https://flic.kr/p/SmhHTd

The Genus Homo

The strong fountain
An underground lake at inside the Sterkfontein Cave system at the Cradle of Humankind (South Africa) Credit: Jeremy Seto [CC-BY-NC-SA] https://flic.kr/p/RczrEg
The rise of the human lineage is thought to arise in Africa. Fossils of Austroloptihs (southern apes) found in death traps, like those at the Cradle of Humankind, reveal a historical record of organisms inhabiting the landscape. The breaks in the ceiling of the caves  provide opportunities for animals to fall inside these caves to their death. The limestone deposits of the caves serve as an environment for fossilization and mineralization of their remains. An abundance of fossilized hominids in these caves including Australopithecus africanus, Australopithecus prometheus, Paranthropus boisei, and the newly discovered Homo naledi continue to reveal the natural history of the genus Homo from 2.6 million to 200,000 years ago.

The entrance to the Sterkfontein Caves
The entrance to the archaeological site at Sterkfontein, Cradle of Humankind (South Africa). Credit: Jeremy Seto [CC-BY-NC-SA] https://flic.kr/p/ULs2Sv

Ancient DNA of Humans

Spread and evolution of Denisovans

In 2008, a  piece of a finger bone and a molar from a Siberian Cave were found that differed  slightly from that of modern humans and Neandertals. The cave, called Denisova Cave, maintains an average temperature of 0ºC year round and the bones were suspected to contain viable soft tissue. An initial mitochondrial DNA analysis revealed that these hominids represented a distinct line of humans that overlapped with them in time (Krause et al., 2010). Analysis of the full nuclear genome followed and indicated that interbreeding existed between these Denisovans, Neandertals and modern humans (Reich et al., 2010). Furthermore, analysis of DNA from a 400,000 year old femur in Spain revealed that these three lines diverged from the species Homo heidelbergensis with Denisovans closest in sequence similarity (Meyer et al., 2016).

Between modern humans, markers found in the mtDNA can be used to trace the migrations and origins along the maternal line. Similarly, VNTRs found on the Y chromosome have revealed migration patterns along paternal lines within men. Other markers, like the insertion points of transposable elements can be used to further describe the genetics and inheritance of modern humans while providing a snapshot into evolutionary history.

Other Resources


Tags: , , , ,