In Silico PCR

Using the primer sequences, one can determine the size and/or location of a PCR product. This can be done using BLAST or with a program like UGENE.

Using BLAST

  1. Primers for the PV92 insertion
    • Forward primer: 5′ GGATCTCAGGGTGGGTGGCAATGCT 3′
    • Reverse primer: 5′ GAAAGGCAAGCTACCAGAAGCCCCAA 3′
  2. Visit BLAST: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch
  3. Paste both primers:
    • GGATCTCAGGGTGGGTGGCAATGCTGAAAGGCAAGCTACCAGAAGCCCCAA
    • Remove the 5′ and 3′ numbers
  4. Choose “Somewhat Similar“
    • Locate the locus of the product and the size

Using Ugene

  1. Exercise using the human D-Loop Primers
    • Forward Primer 5’-TTAACTCCACCATTAGCACC-3’
    • Reverse Primer 5’-GAGGATGGTGGTCAAGGGAC-3’
  2. Download the sample Genbank file: Human Mitochondrial Genome
  3. Open the file in Ugene
  4. Select the “In Silico PCR” button on the far right (double helix button)
    • insert forward and reverse primers in appropriate spaces
    • primerbutton
  5. A PCR product should be noted for one of the sequences after pressing “Find Products anyway“